?

Log in

face

zafania in science_beta

Hi, I'm looking for some visual, rather than written reference material. I want to use DNA strands as a decorative element in a peice of silversmithing, and I was wondering if someone could point me in the direction of a resource to find the pictures want?

The piece I have in mind is a silver beaker with dna strands wound round it in engraving, hopefully as a gift for someone with a phd in genetic engineering who is very keen on gardening - especially palms, angels trumpets and bird of paradise plants, so i need the visual reference to be accurate, any help appreciated.
Tags:

Comments

What kind of visual reference are you looking for? Something like the space-saving ball model in my icon or a specific sequence or something else?
I love the model on your icon buts its a bit complex to render in engraving(curves are hard, and the smaller they get the more difficult to keep straight) I need something simple(ish) but dont really know enough baout the subject to be able to tell if i can have a specific sequence - say a bird of paradise plant(he loves those) - recogniseable at a level i can incorporate into my medium. i also need to bear in mind that i'll have to wokr in monochrome cos i dont have the facilities to enamel at the size the piece will have eto be to be viable.

I really need a little expert guidance, to point me in the right direction and to tell me what might be an acceptable reference to incorporate becasue i dont know enough about the subject to really tell.

this is a link to the piece i'm using as inspiration - the one central to the photo wiht a lid and small dragons crawling round it. its a replica i made a few years ago of a c13th century beaker, i want to use the basic shape and have the dna winding round the beaker in much the same way as the dragons and foliage do, except that i dont intend the strands to be as tightly packed, i want to give a more modern and minimal look by leaving bare silver in between, which will also make the strands stand out more distinctly. I want to mix ancient and modern so that at first glance it will look quite medieval, wiht the modern aspect showing on closer inspection. this piece stands about 6inches high

http://www.anmoddracan.org.uk/silver.jpg
I have no idea off the top of my head if the bird of paradise plant has been sequenced. I work with bacteria; smaller genomes, easier to sequence.

The DNA in my icon is a basic double-helix arrangement. I think anything you're likely to find as a reference will be in that form. When analyzed, DNA is usually textually rendered in a ATCG sequence which isn't very aesthetically pleasing.

Something like this is a very basic representation that doesn't actually incorporate any information.

Because you're friend is a genetic engineer I'm sure he'd recognize a double-helix in minimal form. Without color or a high level of detail I'm not sure it'd be possible to represent a specific sequence. Something like this shows a sequence with ATCG incorporated into the helix. The image itself isn't very pretty but you can see what I mean.

I would try Googling for images of DNA and see if anything appeals to you. Let me know if there's anything else with which I can help you.
I actually kind of like the second one - I'm wondering if i can use it quite large (maybe 3 strands round the beaker) and work the lettering in some kind of bastardised gothic script. i may have to go practice on some scrap metal and see what i can come up with.

I fi can do the second one with reasonable accuracy is it possible to depict a specific sequence this way? I did try google image but got a bit lost - couldn;t see the wood for the trees i think, i was wondering if there was some kind of databas i could browse for the sequence i wanted?

this is really helpful, btw, thanks!
If you can incorporate the ATCG characters into the design, then yes it is possible to include a specific sequence. Do you know if your friend has a specific gene or part of the genome he's interested in? It would be easier to include a small specific sequence that he would recognize as his research rather than a random segment of bird of paradise coding. Short sequences of DNA aren't necessarily very unique. I would recognize CCGTCAATTCATTTGAGTTT as being a bacterial primer I use all the time but it is still short enough that it could occur in many, many other organisms.

I know very little about plant genetics but there is a visiting plant ecologist in our lab. When I see her next I'll ask her if there's a plant genome database somewhere.
I'm not helpful at all, but that sounds extremely cool. Your work is beautiful, and your gift recipient will be one very lucky person to receive it.